Find link

language:

Find link is a tool written by Edward Betts.

searching for DDX3Y 2 found (7 total)

alternate case: dDX3Y

Haplogroup G-M377 (3,411 words) [view diff] exact match in snippet view article find links to article

SNP name gene gene location Y position M377 DDX3Y intron 10 15,536,827 Primer (5'→3') position (bp) SNP forward reverse length (bp) 40 A→T tatgcatttgttgagtatatgtc

Stress granule (12,548 words) [view diff] exact match in snippet view article find links to article

protein 3 DEAD-Box Helicase 3 DDX3X DDX3X DEAD-Box Helicase 3, X-Linked DDX3Y DDX3Y DEAD-Box Helicase 3, Y-Linked DDX31 DDX31 DEAD-Box Helicase 31 DDX47