language:
Find link is a tool written by Edward Betts.searching for SP6 216 found (217 total)
alternate case: sP6
S5 (classification)
(5,848 words)
[view diff]
exact match in snippet
view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleS6 (classification) (3,434 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleS8 (classification) (3,694 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleS7 (classification) (3,288 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleWindows NT 4.0 (3,836 words) [view diff] exact match in snippet view article find links to article
(SP4) October 25, 1998 Service Pack 5 (SP5) May 4, 1999 Service Pack 6 (SP6) October 27, 1999 Service Pack 6a (SP6a) November 22, 1999 Post SP6a SecurityFano Guitars (910 words) [view diff] exact match in snippet view article find links to article
Fano Standard line of guitars was launched in 2016 and includes the JM6, SP6, TC6 and RB6. Dennis Fano, founder of the company, repaired guitars at MattS4 (classification) (4,998 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleS3 (classification) (4,138 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleKLF14 (564 words) [view diff] case mismatch in snippet view article find links to article
encoded by the KLF14 gene. The corresponding Klf14 mouse gene is known as Sp6. KLF14 is a member of the Krüppel-like factor family of transcription factorsF6 (classification) (4,270 words) [view diff] exact match in snippet view article
F6, also SP6, is a wheelchair sport classification that corresponds to the neurological level L2 - L5. Historically, this class has been known as LowerT7 RNA polymerase (1,030 words) [view diff] exact match in snippet view article find links to article
TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription beginsMicrosoft Office 2000 (904 words) [view diff] exact match in snippet view article find links to article
the following version, Microsoft Office XP only supports Windows NT 4.0 SP6 or later. Microsoft released three service packs for Office 2000 throughoutServer-Gated Cryptography (533 words) [view diff] exact match in snippet view article find links to article
supported Netscape Step-Up for compatibility (though this support in the NT 4.0 SP6 and IE 5.01 version had a bug where changing MAC algorithms during Step-UpZindervirus (293 words) [view diff] exact match in snippet view article find links to article
Zindervirus (synonym SP6-like viruses, Sp6likevirus) is a genus of viruses in the family Autographiviridae, within the subfamily Molineuxvirinae. BacteriaF7 (classification) (3,451 words) [view diff] exact match in snippet view article
performance in distance between women in 2 (SP4), 3 (SP4, SP5), 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the discus. It found there was little significant2008 24 Hours of Nürburgring (81 words) [view diff] exact match in snippet view article find links to article
Sabine Schmitz Klaus Abbelen Edgar Viersen Kenneth Heyer Porsche 997 145 4 SP6 64 ORMS Racing Marko Hartung Stefan Neuberger Franz Engstler BMW Z4 M Coupe2015 24 Hours of Nürburgring (94 words) [view diff] exact match in snippet view article find links to article
Echevararria Porsche 997 GT3 Cup 135 28 SP6 81 Felix Horn Markus Horn Jean Hertenstein "Takis" Porsche 991 135 29 SP6 80 Prosport-Performance GmbH Michael2007 24 Hours of Nürburgring (99 words) [view diff] exact match in snippet view article find links to article
Alzen Uwe Alzen Christian Menzel Christian Mamerow Porsche Cayman H 108 ? 5 SP6 50 Motorsport Arena Oschersleben Claudia Hürtgen Hans-Joachim Stuck JohannesMicrosoft Office XP (7,558 words) [view diff] exact match in snippet view article find links to article
earlier versions of Windows. Office XP is compatible with Windows NT 4.0 SP6 or later, Windows 98, Windows 2000, Windows Me, Windows XP, Windows Server2009 24 Hours of Nürburgring (434 words) [view diff] exact match in snippet view article find links to article
Quinn Craig Baird Grant Denyer Porsche 997 RSR M 146 Porsche 3.8L Flat-6 10 SP6 69 Dörr Motorsport Rudi Adams Luca Ludwig Arnd Meier Markus Grossman BMW2014 24 Hours of Nürburgring (115 words) [view diff] exact match in snippet view article find links to article
Richard Meaden Oliver Mathai Andreas Gülden Aston Martin Vantage V8 137 40 SP6 76 Hedemann, Heiko Heiko Hedemann Kevin Warum Guido Schuchert Dirk VleugelsSocket SP5 (335 words) [view diff] exact match in snippet view article find links to article
Socket AM5, contemporary desktop socket from AMD in use since 2022 Socket SP6, server socket for low power and edge systems supporting the Siena family2017 24 Hours of Nürburgring (87 words) [view diff] exact match in snippet view article find links to article
Bohrer Stephan Epp Gerrit Holthaus Michael Uelwer Renault Clio RS Cup 131 60 SP6 81 Hofor-Racing Michael Fischer Cor Euser Bernd Kupper Christian Titze BMWMamod (6,903 words) [view diff] exact match in snippet view article find links to article
similar to the SP6 model in the product range but features twin cylinders. The SP7 utilizes the same boiler and burner unit as the SP6, which can be equippedF5 (classification) (4,953 words) [view diff] exact match in snippet view article
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was littleBank Negara Komuter station (775 words) [view diff] exact match in snippet view article find links to article
as an interchange station with the Ampang and Sri Petaling Lines' AG6 SP6 Bandaraya station. Interchanges between the stations require that one exitAutographiviridae (1,615 words) [view diff] exact match in snippet view article find links to article
coliphage T7, as members of the family Podoviridae. Enterobacteriaceae phages SP6 and K1-5 were the first to be considered as an estranged subgroup of theGorley Lynch (50 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01590 Police Hampshire and Isle of Wight Fire Hampshire and2016 24 Hours of Nürburgring (163 words) [view diff] exact match in snippet view article find links to article
Jacoma Claudius Karch Timo Molig Marc Hennerici Porsche Cayman S 116 35 SP6 83 rent2drive racing David Ackermann Carsten Welschar Jorg Wiskirchen CsabaMiriam Lee (481 words) [view diff] exact match in snippet view article find links to article
Lee describes a combination of points that have wide application: ST36, SP6, LI4, LI11, and LU7. She also popularized the Master Tung Ching Chang's MagicOracle iPlanet Web Server (1,155 words) [view diff] exact match in snippet view article find links to article
iPlanet Web Server 4.1 SP6. iPlanet Web Server 4.1 SP3. iPlanet Web Server 4.1 SP2. iPlanet Web Server 4.1. iPlanet Web Server 4.0 SP6. iPlanet Web ServerF4 (classification) (4,895 words) [view diff] exact match in snippet view article
(SP5, SP6) in the discus. It found there was little significant difference in performance in time between men in 2 (SP4), 3 (SP4, SP5) and 4 (SP5, SP6) inSocket SP6 (420 words) [view diff] exact match in snippet view article find links to article
Socket SP6 (LGA 4844) is a zero insertion force land grid array CPU socket designed by AMD supporting its Zen 4c-based Epyc Siena server processors thatEpyc (3,482 words) [view diff] exact match in snippet view article find links to article
8004 series of CPUs, codenamed Siena. Siena utilizes a new socket, called SP6, which has a smaller footprint and pin count than the SP5 socket of its contemporarySP postcode area (170 words) [view diff] exact match in snippet view article find links to article
Dean, West Tytherley, Whiteparish, Winterslow Dorset, Wiltshire, New Forest SP6 FORDINGBRIDGE Fordingbridge, Alderholt, Rockbourne, Martin New Forest, DorsetBandaraya LRT station (405 words) [view diff] exact match in snippet view article find links to article
AG6 SP6 Bandaraya | LRT station Platform view of the station at daytime General information Location Jalan Raja Laut 50350 WP Kuala Lumpur Coordinates2019 24 Hours of Nürburgring (127 words) [view diff] exact match in snippet view article find links to article
Patrick Kolb Jonathan Miller Johannes Stengel Porsche 911 GT3 Cup 142 26 SP6 80 Schmickler Performance powered by Ravenol Michael Grassl Ivan Jacoma Claudius2006 24 Hours of Nürburgring (133 words) [view diff] exact match in snippet view article find links to article
Schratz Johannes Siegler Arno Klasen Jörg Viebahn Porsche 996 GT3-RS 138 7 SP6 69 Rudi Adams Rainer Dörr Marc Hennerici Gregor Vogler BMW M3 CSL 137 8 SP7North Gorley (342 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town Fordingbridge Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andKalashnikov Concern AMB-17 (567 words) [view diff] exact match in snippet view article find links to article
rifle that uses a heavy subsonic 9×39mm SP5 cartridge and armor-piercing SP6 cartridge. It was developed and manufactured in the late 2010s by KalashnikovLawrence Joel (1,463 words) [view diff] exact match in snippet view article find links to article
gallantry and intrepidity at the risk of life above and beyond the call of duty. SP6 Joel demonstrated indomitable courage, determination, and professional skill2018 24 Hours of Nürburgring (82 words) [view diff] exact match in snippet view article find links to article
Geisselhart "Maximilian" Torleif Nytröen Porsche Cayman GT4 Clubsport 117 50 SP6 65 Proom Racing Michael Grassl Rob Thomson Achim Wawer Volker Wawer PorscheGroupWise (1,658 words) [view diff] exact match in snippet view article find links to article
SP2a Black Widow 1997 5.2 SP6 1 Jolt 1997 5.5 SP5 2 Surge 1998 5.5 EP SP5 3 Aruba 1999 6.0 SP4 4 Bulletproof 2001 6.5 SP6 Update 2 5 Hawthorne 2003 6Lower Daggons (62 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01590 Police Hampshire and Isle of Wight Fire Hampshire andOmniWeb (1,048 words) [view diff] case mismatch in snippet view article find links to article
December 8, 2018. Hicks, Jon (April 27, 2006). "A quick guide to Omniweb 5.5 sp6". Hicksdesign. Retrieved December 8, 2018. Sharps, Linda (September 7, 2006)Hyde, Hampshire (433 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andZen 3 (2,990 words) [view diff] exact match in snippet view article find links to article
new sockets, which are AM5 for the desktop "Ryzen" chips alongside SP5 and SP6 for the EPYC server platform and sTRX8. According to AMD, Zen 3 has a 19%Bickton (371 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andOntario Knife Company (344 words) [view diff] exact match in snippet view article find links to article
version of the original Ka-Bar Mark 3 Navy diving/survival knife Spec Plus SP6 Fighter and SP13 Tango Spec Plus SP25 USN-2 Navy knife Spec Plus SP26 USN-3Ontario Knife Company (344 words) [view diff] exact match in snippet view article find links to article
version of the original Ka-Bar Mark 3 Navy diving/survival knife Spec Plus SP6 Fighter and SP13 Tango Spec Plus SP25 USN-2 Navy knife Spec Plus SP26 USN-3Miracle Linux (322 words) [view diff] exact match in snippet view article find links to article
SP5 2.6.32-696.1.1.el6 X 2016-07-21 Asianux Server 4 == MIRACLE LINUX V6 SP6 2.6.32-642.el6 X 2017-05-26 Asianux Server 4 == MIRACLE LINUX V6 SP7 2.6Furze Hill (158 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andBlissford (147 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andList of One Piece television specials (981 words) [view diff] exact match in snippet view article find links to article
Pirates. After a days-long celebration, Nami re-joins the Straw Hat crew. SP6 "Episode of Luffy: Adventure on Hand Island" Transliteration: "Episōdo obuAlloxylon (300 words) [view diff] exact match in snippet view article find links to article
Wikidata: Q2698344 Wikispecies: Alloxylon APNI: 118921 BOLD: 279257 CoL: SP6 EoL: 2869471 EPPO: 1AXNG FoAO2: Alloxylon GBIF: 7287212 GRIN: 431 iNaturalist:2011 24 Hours of Nürburgring (488 words) [view diff] exact match in snippet view article find links to article
Stephan Wölflick Urs Bressan Jürgen Gagstatter Carsten Foese Ford Focus 127 64 SP6 92 Michael Alhäuser Ronny Weber Kenij Kobayashi "Quick Vick" BMW M3 E46 127Sandleheath (193 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town Fordingbridge Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andFrogham, Hampshire (429 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andVSK-94 (267 words) [view diff] exact match in snippet view article find links to article
1 in) Width 83 mm (3.3 in) Height 280 mm (11.0 in) Cartridge 9x39mm SP5 and SP6; also PAB-9 including later variants SPP, BP Action Gas-operated, rotatingKruppel-like factors (2,233 words) [view diff] case mismatch in snippet view article find links to article
are Sp factors: Sp1, Sp2, Sp3, Sp4, Sp5, Sp6, Sp7, Sp8, and Sp9. Note that although KLF14 was an alias for Sp6 (Q3SY56), it now refers to a protein (Q8TD94)Woodgreen (666 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Police Hampshire and Isle of Wight Fire Hampshire and Isle of Wight AmbulanceMartin, Hampshire (666 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andSouth Charford (611 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andStuckton (238 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 2 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andBurgate, Hampshire (654 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andDamansara Town Centre (351 words) [view diff] exact match in snippet view article find links to article
Hartamas, Mid Valley Megamall and the Ampang and Sri Petaling Lines' AG6 SP6 Bandaraya station. Jalan Damanlela Jalan Damansutera Jalan Damansari JalanOgdens (198 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andSpähkreuzer 1938 (292 words) [view diff] exact match in snippet view article find links to article
Kiel to build these vessels. In December 1941, 3 engines for SP4, SP5 and SP6 were ordered but not the ships. SP1 was the only ship for which the keelSamsung Epix (741 words) [view diff] exact match in snippet view article find links to article
on which ActiveSync 4.5 can be installed, are Windows NT Workstation 4.0 SP6 (or later) and Windows Me, requiring Internet Explorer 6 to be present inTakayuki Kinoshita (527 words) [view diff] exact match in snippet view article find links to article
Nürburgring Nordschleife, Class SP6 »(single race) 6th Sport Auto » / Honda NSX Type-R » GT 2006 24h Nürburgring Nordschleife, Class SP6 »(single race) Sport Auto »Ampang and Sri Petaling lines (2,797 words) [view diff] exact match in snippet view article find links to article
AG4/SP4 PWTC KA04 Putra 12 AG5/SP5 Sultan Ismail MR9 Medan Tuanku 8 AG6/SP6 Bandaraya KA03 Bank Negara 12 KJ13 AG7/SP7 Masjid Jamek 5 AG8/SP8 Plaza RakyatWhitsbury (738 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andNorth Charford (727 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andTagetitoxin (997 words) [view diff] exact match in snippet view article find links to article
and II as well as single-subunit RNA polymerases of bacteriophage T7 and SP6 are relatively insensitive to the compound. TGT binds in the RNAP active2020 Nürburgring Langstrecken-Serie (753 words) [view diff] exact match in snippet view article find links to article
standings". Driver Database AB. "Nürburgring Langstrecken Serie - VLN Specials SP6 up to 3500 ccm class 2020 standings". Driver Database AB. "Nürburgring LangstreckenBacterial artificial chromosome (925 words) [view diff] case mismatch in snippet view article find links to article
some BACs also have lacZ at the cloning site for blue/white selection. T7 & Sp6 phage promoters for transcription of inserted genes. BACs are now being utilizedLokai (421 words) [view diff] exact match in snippet view article find links to article
Hewicker-Trautwein, Ottmar Distl1, Julia Metzger (2018). An epistatic effect of KRT25 on SP6 is involved in curly coat in horses. Scientific Reports. 8: 6374. doi:10The Burgate School and Sixth Form (405 words) [view diff] exact match in snippet view article find links to article
The Burgate School Address Salisbury Road Fordingbridge , Hampshire , SP6 1EZ England Coordinates 50°56′13″N 1°47′13″W / 50.937°N 1.787°W / 50.937;2012 24 Hours of Nürburgring (303 words) [view diff] exact match in snippet view article find links to article
Division 1 – Group 24h-Special Normally aspirated engines: SP3, SP4, SP5, SP6, SP7, SP8, SP9 (FIA-GT3), SP10 (SRO-GT4) Turbo engines: SP3T, SP4T, SP8TGodshill, Hampshire (847 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andF57 (classification) (3,734 words) [view diff] exact match in snippet view article
performance in distance between women in 2 (SP4), 3 (SP4, SP5), 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the discus. It found there was little significantSAP Afaria (1,007 words) [view diff] exact match in snippet view article find links to article
Released October 2015 (as SAP Afaria SP7) Version 7.0 SP6: Released September 2015 (as SAP Afaria SP6) Version 7.0 SP5: Released August 2014 (as SAP AfariaRockbourne (1,041 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andDouglas A. Melton (1,193 words) [view diff] exact match in snippet view article find links to article
He also pioneered the technique of in vitro transcription with bacterial SP6 RNA polymerase. This RNA transcription system is now widely used to makeAccess Database Engine (3,136 words) [view diff] exact match in snippet view article find links to article
installers Jet 3.51 web download 3.5+ MDAC 2.1 4.0 SP1 MDAC 2.5 4.0 SP3 to SP6+ Jet 4.0 4.0 SP3 to SP8 2007 Office System Driver ACE 12 Microsoft AccessConway group Co2 (1,160 words) [view diff] case mismatch in snippet view article find links to article
above; 210:M22 fixes a 2-2-4 triangle. McL fixes a 2-2-3 triangle. 21+8:Sp6(2) - centralizer of involution class 2A (trace -8) HS:2 fixes a 2-3-3 triangleMythBusters (2005 season) (2,244 words) [view diff] exact match in snippet view article
MythBusters showed their favorite places to shop. Note: This is a special episode. SP6 Special–5 "MythBusters Revealed" April 27, 2005 (2005-04-27) 39 This is a3CX Phone System (885 words) [view diff] exact match in snippet view article find links to article
2015 v14 44241 1 September 2015 v12.5 12.5.37957.880 21 October 2014 v12 SP6 36097.67 6 June 2014 v12 SP5 35528.64 5 May 2014 v12 SP4 34902.6 4 MarchCapital Square (475 words) [view diff] exact match in snippet view article find links to article
Omnibus and GoKL. The complex is also near SP7 KJ13 LRT Masjid Jamek, SP6 LRT Bandaraya, KA03 KTM Bank Negara and KJ12 LRT Dang Wangi. MenaraKelvin van der Linde (896 words) [view diff] exact match in snippet view article find links to article
Masters Car Collection Motorsport 10 0 0 0 0 1 54th 24 Hours of Nürburgring - SP6 Prosport-Performance GmbH 1 0 0 0 0 N/A DNF 2017 ADAC GT Masters Aust MotorsportBreamore (1,164 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andSocket SP3 (470 words) [view diff] exact match in snippet view article find links to article
Naples Rome Milan Predecessor Socket C32 Socket G34 Successor Socket SP5 Socket SP6 Memory support ECC DDR4 This article is part of the CPU socket seriesList of rail transit stations in the Klang Valley area (972 words) [view diff] exact match in snippet view article find links to article
Petaling Line Rapid Rail LRT Kuala Lumpur 31 October 2015 Bandaraya AG6 SP6 3 Ampang Line 4 Sri Petaling Line Rapid Rail LRT Kuala Lumpur 16 DecemberHale, Hampshire (971 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andDamerham (1,231 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire andCrimeAnalyst (135 words) [view diff] exact match in snippet view article find links to article
0 More ArcToolbox tools for use with ModelBuilder, rectangular 24hr or seasonal data clocks, point cluster renderer, temporal slider 9.2 SP6 – 9.3.1NFYB (1,235 words) [view diff] exact match in snippet view article find links to article
T (1998). "Purification and characterization of a protein binding to the SP6 kappa promoter. A potential role for CArG-box binding factor-A in kappa transcription"Italy–Slovenia border (329 words) [view diff] exact match in snippet view article find links to article
Gorizia (Italy) and Nova Gorica, which lie next to each other. A34 / H4 SP6 / 617 SR58 / A3 / E61 + E70 SP10 / 205 SS14 / E61 / 7 SP13 / 627 SS15 / H5Crendell (111 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Dorset Fire Dorset and Wiltshire Ambulance SouthNuclease protection assay (397 words) [view diff] exact match in snippet view article find links to article
interest in a vector under the control of any of the following promoters, SP6, T7 or T3. These promoters are recognized by DNA dependent RNA polymerases2019 VLN Series (913 words) [view diff] exact match in snippet view article find links to article
4000cc and a turbocharger. SP10 – For FIA- and SRO-homologated GT4 cars. SP6 – Purpose-built racecars with an engine capacity between 3000 and 3499ccQuasithin group (493 words) [view diff] case mismatch in snippet view article find links to article
and rank 1 or 2, except that U5(q) only occurs for q = 4 PSL4(2), PSL5(2), Sp6(2) The alternating groups on 5, 6, 8, 9, points PSL2(p) for p a Fermat orSocket sTR5 (247 words) [view diff] exact match in snippet view article find links to article
PRO CPU and a WRX90 motherboard. Ryzen Socket sWRX8 Socket sTRX4 Socket SP6 Bonshor, Gavin (October 19, 2023). "AMD Unveils Ryzen Threadripper 7000 Family:John Miller Cooper (900 words) [view diff] exact match in snippet view article find links to article
First Jump Shot," The New York Times, April 2, 2011, New York edition, pg. SP6. John Christgau, Origins of the Jump Shot: Eight Men Who Shook the WorldPusat Bandar Damansara MRT station (423 words) [view diff] exact match in snippet view article find links to article
Heights-Pusat Bandar Damansara station Entrance B Kuala Lumpur City Hall SP6 LRT Bandaraya KA03 KTM Bank Negara Jalan Johar Jalan Semantan Jalan TuankuTreaty of Perpetual Peace (812 words) [view diff] exact match in snippet view article find links to article
Office, E39/58, E39/59, E39/81; and Edinburgh National Archives of Scotland, SP6/31. Accounts of the Treasurer of Scotland, vol. 2 (Edinburgh, 1900), pp.Fordingbridge (1,770 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire andZen 4 (3,994 words) [view diff] exact match in snippet view article find links to article
Desktop Socket AM5 HEDT/Workstation Socket sTR5 Server Socket SP5 Socket SP6 Products, models, variants Product code name(s) Desktop Raphael Phoenix (APUs)KLF11 (1,397 words) [view diff] exact match in snippet view article find links to article
M, Szpirer J, Szpirer C (Nov 2000). "Identification of KLF13 and KLF14 (SP6), novel members of the SP/XKLF transcription factor family". Genomics. 70Wheelchair sport classification (4,365 words) [view diff] exact match in snippet view article find links to article
swimmers may be found in S3 and S5. SP5 swimmers may be classified as S4 or S5. SP6 swimmers can be found in S5. SP7 swimmers may be in S5 or S6. SP8 swimmersBroxhill (310 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01590 Police Dorset Fire Dorset and Wiltshire Ambulance SouthNet (command) (684 words) [view diff] exact match in snippet view article
lot of information about a remote user. This has changed in Windows NT 4.0 SP6 already. In Windows 2000 "null session connections" could have been enabledTasuku Honjo (1,467 words) [view diff] exact match in snippet view article find links to article
cDNA encoding the murine IgG1 induction factor by a novel strategy using SP6 promoter". Nature. 319 (6055): 640–646. Bibcode:1986Natur.319..640N. doi:10Tanjung Malim–Port Klang Line (1,266 words) [view diff] exact match in snippet view article find links to article
Caves-Pulau Sebang Line KA03 Bank Negara Side Connecting station to AG6 SP6 Bandaraya on the LRT Ampang & Sri Petaling Lines via a 250-meter pedestrianVisual Studio (15,350 words) [view diff] exact match in snippet view article find links to article
version to support the Windows 9x platform, as well as Windows NT 4.0 before SP6, but after SP2. Each version of each language in part also settled to v6Batu Caves–Pulau Sebang Line (1,174 words) [view diff] exact match in snippet view article find links to article
Malim-Port Klang Line KA03 Bank Negara Side Connecting station to AG6 SP6 Bandaraya on the LRT Ampang & Sri Petaling Lines via a 250-meter pedestrianDetrended correspondence analysis (936 words) [view diff] exact match in snippet view article find links to article
0 0 0 0 0 0 0 0 0 0 0 0 0 0 SP5 0 0 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 SP6 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 SP7 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0Alex Buncombe (489 words) [view diff] exact match in snippet view article find links to article
European Cup RJN Motorsport 12 5 3 6 9 88 2nd 24 Hours of Nürburgring - SP6 1 0 0 0 0 N/A 4th 2009 GT4 European Cup RJN Motorsport 12 2 1 2 6 57 2ndAlderholt (364 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Dorset Fire Dorset and Wiltshire Ambulance SouthRank 3 permutation group (765 words) [view diff] case mismatch in snippet view article find links to article
Hoffman-Singleton graph; three classes U4(3) L3(4) 162 = 1+56+105 Two classes Sp6(2) G2(2) = U3(3):2 120 = 1+56+63 The Chevalley group of type G2 acting onCripplestyle (241 words) [view diff] exact match in snippet view article find links to article
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Dorset Fire Dorset and Wiltshire Ambulance SouthIndex of molecular biology articles (1,928 words) [view diff] exact match in snippet view article find links to article
solution hybridization - somatic cells - Southern blot - southwestern blot - SP6 RNA polymerase - SpAB protein domain - spectral karyotype - splicing - SimpleHuman Brain Project (2,201 words) [view diff] exact match in snippet view article find links to article
Neuroinformatics Platform: Gathering, organising and making available brain data SP6 Brain Simulation Platform: Developing data-driven reconstructions of brain2009 Voloshina (1,026 words) [view diff] exact match in snippet view article find links to article
designations 1968 UL · 1926 FF 1929 TO · 1957 WF2 1959 EC · 1970 EL1 1973 SP6 · 1973 SU3 Minor planet category main-belt · (outer) Orbital characteristicsSpecialist (rank) (3,048 words) [view diff] exact match in snippet view article
abbreviation was changed from "SP4" to "SPC" upon the elimination of the SP5 and SP6 ranks, the SIDPERS database was authorized to continue using SP4 until theCPU socket (730 words) [view diff] exact match in snippet view article find links to article
Genoa and Milan LGA 4677 2022 Intel Sapphire Rapids Server LGA 4677 Socket SP6 2023 AMD Epyc Siena Server LGA 4844 Socket sTR5 2023 AMD Ryzen ThreadripperList of Aisin transmissions (1,650 words) [view diff] exact match in snippet view article find links to article
Petrol & Diesel, Roewe 550, Mazda6, Mazda CX-7, Mazda CX-9, Land Rover LR2 SP6 — 6-speed *** 996= Getrag 450 Porsche 911 SA6 - 6-speed Lexus LFA April 1997–List of 2020 motorsport champions (545 words) [view diff] exact match in snippet view article find links to article
Florian Naumann Cup 2: Georg Goder Cup 2: Martin Schlüter SP6: Stefan Schmickler SP6: Achim Wawer SP6: Volker Wawer SP4T: Ralf Zensen SP-PRO: Marek BöckmannPhilaenarcys bilineata (93 words) [view diff] case mismatch in snippet view article find links to article
"Unraveling the Enigma of an Atlantic Prairie". Northeastern Naturalist. 19 (sp6). Humboldt Field Research Institute: 13–42. doi:10.1656/045.019.s603. ISSN 1092-6194Philippe Haezebrouck (85 words) [view diff] exact match in snippet view article find links to article
Endurance Moderne - Proto Promodrive ? 0 0 0 0 45 19th 24 Hours of Nürburgring - SP6 MSC Rhön 1 0 ? ? 0 N/A 4th 2007 V de V Challenge Endurance Moderne - ProtoPHD finger protein 7 (188 words) [view diff] exact match in snippet view article find links to article
PHF7 Identifiers Aliases PHF7, HSPC045, HSPC226, NYD-SP6, PHD finger protein 7 External IDs MGI: 1919088 HomoloGene: 69217 GeneCards: PHF7 Wikidata2021 Nürburgring Langstrecken-Serie (1,614 words) [view diff] exact match in snippet view article find links to article
turbocharged-engine capacity between 2000 and 2599 cc and a turbocharger. SP6 Purpose-built racecars with an engine capacity between 3000 and 3499 cc.Mario Farnbacher (922 words) [view diff] exact match in snippet view article find links to article
Blancpain GT Series Endurance Cup 1 0 0 0 0 11 20th 24 Hours of Nürburgring - SP6 SetupWizzard Racing 1 0 1 1 1 N/A 2nd 2020 IMSA SportsCar Championship -Klaus Niedzwiedz (701 words) [view diff] exact match in snippet view article find links to article
Supercopa VIP SEAT Deutschland 2 0 0 0 0 0 NC 24 Hours of Nürburgring - SP6 Sport Auto 1 0 ? ? 0 N/A 7th 2008 24 Hours of Nürburgring - SP Cup DanielaBlackBerry Unified Endpoint Manager (2,010 words) [view diff] exact match in snippet view article find links to article
As such, BPS is missing out on some functions that full BES did get from SP6 onwards, such as rich content email, free/busy search, and remote searchKlimovsk Specialized Ammunition Plant (837 words) [view diff] exact match in snippet view article find links to article
low-penetration (plane hostage crisis scenario) pistol cartridge 9×39mm 'SP6' subsonic sniper cartridge with armor-piercing steel-core bullet 9×39mm 'SP5'Simple Lie group (2,262 words) [view diff] case mismatch in snippet view article find links to article
21 SO5,2(ℝ) Hermitian 21 SO4,3(ℝ) Split, quaternionic 21 Sp(3) Compact 21 Sp6(ℝ) Split, hermitian 21 Sp4,2(ℝ) Quaternionic 24 SU(5) Compact 24 SL5(ℝ) Split2022 Nürburgring Langstrecken-Serie (95 words) [view diff] exact match in snippet view article find links to article
Purpose-built racecars with an engine capacity between 2500 and 2999 cc. SP6 Purpose-built racecars with an engine capacity between 3000 and 3499 cc.Nicki Thiim (747 words) [view diff] exact match in snippet view article find links to article
Supercopa Germany GAG Racing Team 16 8 5 4 12 265 1st 24 Hours of Nürburgring - SP6 RJN Motorsport 1 0 0 0 0 N/A ? 2009 Porsche Carrera Cup Germany AttemptoConway group Co3 (1,111 words) [view diff] case mismatch in snippet view article find links to article
fixes a 2-3-4 triangle. 35:(2 × M11) - fixes or reflects a 3-3-3 triangle. 2.Sp6(2) – centralizer of involution class 2A (trace 8), which moves 240 of theEndoribonuclease-prepared siRNA (663 words) [view diff] exact match in snippet view article find links to article
"Efficient RNA interference in zebrafish embryos using synthesized with SP6 RNA polymerase". Dev Growth Differ. 47 (5): 323–31. doi:10.1111/j.1440-169xUnited States Army enlisted rank insignia (5,469 words) [view diff] exact match in snippet view article find links to article
Specialist insignia of 1959 E9 E8 E7 E6 E5 E4 Specialist 9 Specialist 8 Specialist 7 Specialist 6 Specialist 5 Specialist 4 SP9 SP8 SP7 SP6 SP5 SP4List of major Super Smash Bros. Ultimate tournaments (3,708 words) [view diff] exact match in snippet view article find links to article
Nicholas (October 21, 2019). "Umebura SP6 results". EventHubs. Retrieved June 27, 2020. "ウメブラSP6 /UmeburaSP6 | シングルストーナメント / Singles". smash.gg. OctoberBernd Schneider (racing driver) (833 words) [view diff] exact match in snippet view article
Tourenwagen Masters HWA Team 10 2 0 2 7 71 1st 24 Hours of Nürburgring - SP6 Raeder Motorsport 1 0 ? ? 0 N/A 6th 2007 Deutsche Tourenwagen Masters HWAAkalyptoischion (409 words) [view diff] case mismatch in snippet view article find links to article
Akalyptoischion Andrews (Coleoptera: Latridiidae)". The Coleopterists Bulletin. 61 (sp6): 1–50. doi:10.1649/0010-065X(2008)61[1:ATROTG]2.0.CO;2. ISSN 0010-065X.2007 Canadian Soccer League season (1,553 words) [view diff] exact match in snippet view article find links to article
2007). "Fans fume amid rain and rancour at Esther Shiner". Toronto Sun. pp. SP6. McNulty, Dean (29 October 2007). "A bittersweet championship; Croatia claimsDamocloid (899 words) [view diff] exact match in snippet view article find links to article
PN66 31.02 0.906 105.2 TNO Y -0.373 Y 2.9 59.13 unusual — MPC · JPL 2016 SP6 8.54 0.828 4.9 CEN — 2.040 — 1.47 15.61 — — MPC · JPL 2016 TK2 9.2 0.551Hans-Joachim Stuck (924 words) [view diff] exact match in snippet view article find links to article
Prix Masters Team Phantom 2 0 0 0 0 3 5th 2007 24 Hours of Nürburgring - SP6 Motorsport Arena Oschersleben 1 1 1 ? 1 N/A 1st 2008 24 Hours of NürburgringSpastic paraplegia 6 (493 words) [view diff] exact match in snippet view article find links to article
memory problems. There are various complications related to the symptoms of SP6 For example, the pes cavus deformity can cause claw toes, hindfoot deformityMicrosoft Access (6,622 words) [view diff] exact match in snippet view article find links to article
Professional, Premium and Developer Access 2002 10.0 May 31, 2001 Windows NT 4.0 SP6, Windows 98, Windows 2000, Windows Me Office XP Professional and DeveloperThe Fullerton Hotel Singapore (3,424 words) [view diff] exact match in snippet view article find links to article
location of One Fullerton have pulled in the crowds". The Sunday Times. p. SP6. Re-shaping Cities : How Global Mobility Transforms Architecture and UrbanHans-Joachim Stuck (924 words) [view diff] exact match in snippet view article find links to article
Prix Masters Team Phantom 2 0 0 0 0 3 5th 2007 24 Hours of Nürburgring - SP6 Motorsport Arena Oschersleben 1 1 1 ? 1 N/A 1st 2008 24 Hours of NürburgringShoujocon (391 words) [view diff] exact match in snippet view article find links to article
Welcomes AZZURRI!". Newsgroup: rec.arts.anime.fandom. Usenet: WiKH6.14125$sP6.599768@news3.aus1.giganews.com. Retrieved 2007-03-06. L. Cintron (2002-07-02)Microsoft Visual C++ (4,333 words) [view diff] exact match in snippet view article find links to article
0 97 1100 5 Visual Studio 6.0 SP5 6.0 1200 12008804 6 Visual Studio 6.0 SP6 6.0 1200 12008804 6 Visual Studio .NET 2002 [7.0] 7.0 2002 1300 13009466F56 (classification) (4,020 words) [view diff] exact match in snippet view article
performance in distance between women in 2 (SP4), 3 (SP4, SP5) and 4 (SP5, SP6) in the discus. It found there was little significant difference in performanceSubaru Tecnica International (3,363 words) [view diff] exact match in snippet view article find links to article
2008, the first factory-backed entry finished 57th overall and 5th in the SP6 class. For 2009, STI switched to the SP3T class (production cars equippedEverett E. Vokes (813 words) [view diff] exact match in snippet view article find links to article
Giants of cancer care announced". Evidence-Based Oncology. July/August. 19 (SP6). American Journal of Managed Care. August 23, 2013. Retrieved February 14Augusto Farfus (952 words) [view diff] exact match in snippet view article find links to article
Championship BMW Team Germany 24 6 3 1 9 113 3rd 24 Hours of Nürburgring - SP6 Motorsport Arena Oschersleben 1 0 0 0 0 N/A DNF 2010 World Touring Car ChampionshipHayden Fitzwilliams (1,484 words) [view diff] exact match in snippet view article find links to article
2007). "Fans fume amid rain and rancour at Esther Shiner". Toronto Sun. pp. SP6. McCarthy, Gary (October 29, 2007). "Croatia on top, for now". MississaugaInstitute and Faculty of Actuaries (2,299 words) [view diff] exact match in snippet view article find links to article
Insurances SP4 - Pensions and other Benefits SP5 - Investment and Finance SP6 - Financial Derivatives SP7 - General Insurance - Reserving and Capital ModellingEastern screech owl (5,915 words) [view diff] case mismatch in snippet view article find links to article
Data in Suburban New York and Connecticut". Northeastern Naturalist. 19 (sp6): 143–158. doi:10.1656/045.019.s611. ISSN 1092-6194. S2CID 56388364. ArtusoPhage-assisted continuous evolution (1,432 words) [view diff] exact match in snippet view article find links to article
polymerases were evolved to recognize different promoters, such as the T3 or SP6 promoters. This was done by making the target promoter the sole promoterList of United States servicemembers and civilians missing in action during the Vietnam War (1970–71) (3,308 words) [view diff] exact match in snippet view article
2013. "Leonard Schoeppner, LT". Virtualwall.org. Retrieved 21 April 2013. "SP6 Edward Robinson". Virtualwall.org. Retrieved 21 April 2013. "MAJ Gary BernardBoard on Infrastructure and Constructed Environment (1,235 words) [view diff] exact match in snippet view article find links to article
practice to the late 1960s, producing updates in 1961 (SP3), 1963 (SP5), 1965 (SP6), 1968 (SP8). An example of the work performed by this committee is its studyBeyblade Burst (3,686 words) [view diff] exact match in snippet view article find links to article
Dual-Rotation!!" (レジェンドスプリガン、閃光の両回転!!, Rejendo Supurigan, Senkō no Ryō Kaiten!!) SP6. "The Invincible Turn, Shadow Orichalcum (Part 1)" (無敵旋回シャドウオリハルコン (前編),Complex reflection group (2,292 words) [view diff] case mismatch in snippet view article find links to article
PSU4(2).Z2 [32,2,1], 51840 236 2,5,6,8,9,12 0,3,4,6,7,10 36 7 W(E7) = Z2 ×Sp6(2) [33,2,1], 2903040 263 2,6,8,10,12,14,18 0,4,6,8,10,12,16 37 8 W(E8)= Z2List of postcode districts in the United Kingdom (498 words) [view diff] exact match in snippet view article find links to article
Hampshire SP SP01 SP1, SP2, SP3, SP4, SP5 Salisbury (Wiltshire) SP SP06 SP6 Fordingbridge Hampshire SP SP07 SP7 Shaftesbury Dorset SP SP08 SP8 GILLINGHAMOpenOffice.org (11,803 words) [view diff] exact match in snippet view article find links to article
1 Mac OS X v10.4-Mac OS X v10.6: v4.0 Windows 95: v1.1.5 Windows NT 4.0 SP6: v1.1.x Windows 98 and Windows ME: v2.4.3 Windows 2000 Service Pack 2 orInternet Explorer version history (5,365 words) [view diff] exact match in snippet view article find links to article
version of Internet Explorer to run on Windows 95 and Windows NT 4.0 SP3–SP6. The following version, Internet Explorer 6, works only on Windows NT 4.0Disability sport classification (11,218 words) [view diff] exact match in snippet view article find links to article
Wheelchair basketball: 2-point player Wheelchair fencing: 2, 3/Category B, A F6/SP6 Lower 4, Upper 5 L2 - L5 F56 S5, SB5, S7, S8 Wheelchair basketball: 3-point1999 FIFA Women's World Cup (12,296 words) [view diff] exact match in snippet view article find links to article
Hope, Cautiously, That a New Pro League Will Form". The New York Times. p. SP6. Archived from the original on September 6, 2012. Retrieved May 13, 2019Environment variable (10,249 words) [view diff] exact match in snippet view article find links to article
Application Data directory of the logged-in user. Does not work on Windows NT 4.0 SP6 UK. %LOCALAPPDATA% This variable is the temporary files of Applications.2021 24 Hours of Nürburgring (500 words) [view diff] exact match in snippet view article find links to article
mcchip-dkr Lucas Lange Sascha Lott Alexander Meixner BMW 325i 45 +14 laps 86 SP6 81 Hofor Racing Gustav Engljähringer Martin Kroll Michael Kroll Chantal PrinzDragon NaturallySpeaking (995 words) [view diff] exact match in snippet view article find links to article
Standard, Preferred, Professional, Legal, Medical Windows 98, Me, NT 4.0 SP6+, 2000. 6.0 November 15, 2001 Essentials, Standard, Preferred, ProfessionalPermian–Triassic extinction event (37,299 words) [view diff] case mismatch in snippet view article find links to article
"An Analysis of the History of Marine Animal Diversity". Paleobiology. 33 (sp6): 1–55. Bibcode:2007Pbio...33R...1S. doi:10.1666/06020.1. S2CID 86014119List of minor planets: 4001–5000 (275 words) [view diff] exact match in snippet view article find links to article
April 10, 1978 La Silla H. Debehogne V 5.3 km MPC · JPL 4685 Karetnikov 1978 SP6 Karetnikov September 27, 1978 Nauchnij N. S. Chernykh THM 19 km MPC · JPLList of Windows Mobile devices (293 words) [view diff] exact match in snippet view article find links to article
v1210, and v1240 Windows Mobile 5.0 Smartphone Yes i-mate SP Jas, SP5, SP5m, SP6, SPL, and Smartflip. Windows Mobile 5.0 Smartphone Yes Startronics SuperphoneList of minor planets: 9001–10000 (274 words) [view diff] exact match in snippet view article find links to article
1981 Kiso H. Kosai, K. Furukawa EUN 7.2 km MPC · JPL 9154 Kolʹtsovo 1982 SP6 Kolʹtsovo September 16, 1982 Nauchnij L. I. Chernykh EOS 9.9 km MPC · JPLWilliam Kwong Yu Yeung (265 words) [view diff] exact match in snippet view article find links to article
PO86 13 August 2002 list (114620) 2003 EL4 6 March 2003 list (115082) 2003 SP6 17 September 2003 list (115152) 2003 SA68 17 September 2003 list (115311)Premenstrual water retention (2,506 words) [view diff] exact match in snippet view article find links to article
hormone regulating properties and regulation of the nervous system include SP6, LR3, and RN4. Qigong is another practice that consists of meditation, breathing-exercisesStorage Wars season 5 (1,053 words) [view diff] exact match in snippet view article find links to article
"Best Of: Jarrod and Brandi" Compilation August 19, 2014 (2014-08-19) N/A SP6 TBA "Best Of: Darrell and Brandon" Compilation August 26, 2014 (2014-08-26)Meanings of minor planet names: 4001–5000 (420 words) [view diff] exact match in snippet view article find links to article
the Nice Observatory in southeast France MPC · 4684 4685 Karetnikov 1978 SP6 Valentin Grigor'evich Karetnikov (born 1938), astronomer, professor at OdessaMeanings of minor planet names: 9001–10000 (735 words) [view diff] exact match in snippet view article find links to article
Okayama Astrophysical Observatory is situated. JPL · 9153 9154 Kolʹtsovo 1982 SP6 Kolʹtsovo, a suburb of Novosibirsk, is the site of the State Scientific InstituteList of minor planets: 35001–36000 (274 words) [view diff] exact match in snippet view article find links to article
RJ3 — September 14, 1990 Palomar H. E. Holt · 2.1 km MPC · JPL 35083 1990 SP6 — September 22, 1990 La Silla E. W. Elst FLO 2.0 km MPC · JPL 35084 1990Luca Ludwig (85 words) [view diff] exact match in snippet view article find links to article
Masters Callaway Competition 14 3 1 2 6 67 2nd 24 Hours of Nürburgring - SP6 Dörr Motorsport 1 1 ? ? 1 N/A 1st 2010 ADAC GT Masters Abt Sportsline 14List of minor planets: 66001–67000 (274 words) [view diff] exact match in snippet view article find links to article
1998 SY1 — September 17, 1998 Caussols ODAS · 5.2 km MPC · JPL 66095 1998 SP6 — September 20, 1998 Kitt Peak Spacewatch · 4.7 km MPC · JPL 66096 1998List of American Chopper episodes (658 words) [view diff] exact match in snippet view article find links to article
SP5 Special–1 "History of the OCC" November 14, 2005 (2005-11-14) N/A 68 SP6 Special–2 "Behind the Scenes" November 21, 2005 (2005-11-21) N/A 69 SP7 Special–3List of minor planets: 118001–119000 (274 words) [view diff] exact match in snippet view article find links to article
RD104 — September 6, 2000 Socorro LINEAR EUN 3.1 km MPC · JPL 118791 2000 SP6 — September 21, 2000 Socorro LINEAR CLO 4.7 km MPC · JPL 118792 2000 SZ14List of MythBusters episodes (1,128 words) [view diff] exact match in snippet view article find links to article
MythBusters showed their favorite places to shop. Note: This is a special episode. SP6 Special–5 "MythBusters Revealed" April 27, 2005 (2005-04-27) 39 This is aList of Storage Wars episodes (1,483 words) [view diff] exact match in snippet view article find links to article
"Best Of: Jarrod and Brandi" Compilation August 19, 2014 (2014-08-19) N/A SP6 TBA "Best Of: Darrell and Brandon" Compilation August 26, 2014 (2014-08-26)Micropeptide (3,894 words) [view diff] exact match in snippet view article find links to article
cloning the full-length micropeptide cDNA into a plasmid containing a T7 or SP6 promoter. This method utilizes a cell-free protein-synthesizing system inList of minor planets: 115001–116000 (274 words) [view diff] exact match in snippet view article find links to article
September 16, 2003 Kitt Peak Spacewatch MAS 1.0 km MPC · JPL 115082 2003 SP6 — September 17, 2003 Desert Eagle W. K. Y. Yeung · 1.5 km MPC · JPL 115083List of minor planets: 152001–153000 (274 words) [view diff] exact match in snippet view article find links to article
September 10, 1997 Prescott P. G. Comba · 2.2 km MPC · JPL 152643 1997 SP6 — September 23, 1997 Kitt Peak Spacewatch MAS 1.1 km MPC · JPL 152644 1997Eric Walter Elst (357 words) [view diff] exact match in snippet view article find links to article
QH8 16 August 1990 list (35081) 1990 QT8 16 August 1990 list (35083) 1990 SP6 22 September 1990 list (35084) 1990 SP9 22 September 1990 list 35087 vonList of minor planets: 74001–75000 (274 words) [view diff] exact match in snippet view article find links to article
1999 SY5 — September 30, 1999 Socorro LINEAR · 3.9 km MPC · JPL 74790 1999 SP6 — September 30, 1999 Socorro LINEAR · 2.0 km MPC · JPL 74791 1999 SW6 —List of minor planets: 264001–265000 (274 words) [view diff] exact match in snippet view article find links to article
— September 22, 2003 Anderson Mesa LONEOS · 910 m MPC · JPL 264229 2010 SP6 — October 1, 2003 Kitt Peak Spacewatch · 860 m MPC · JPL 264230 2010 SP10CPUID (11,410 words) [view diff] exact match in snippet view article find links to article
= 0 (which is so by default). As the name suggests, Windows NT 4.0 until SP6 did not boot properly unless this bit was set, but later versions of WindowsList of Crayon Shin-chan episodes (2012–present) (11 words) [view diff] exact match in snippet view article
夢のカレー大会だゾ(2013年)〈再〉) "Handmade Jiaozi (2013) <again>" (Japanese: 手作りギョーザだゾ(2013年)〈再〉) Good–SP6 "Going to Father Farm (2014) <again>" (Japanese: ファザー牧場に行くゾ(2014年)〈再〉) June 6List of minor planets: 390001–391000 (274 words) [view diff] exact match in snippet view article find links to article
TQ5 — October 4, 1994 Kitt Peak Spacewatch · 2.2 km MPC · JPL 390516 1995 SP6 — September 17, 1995 Kitt Peak Spacewatch MAR 1.1 km MPC · JPL 390517 1995San Fedele, Albenga (3,192 words) [view diff] exact match in snippet view article find links to article
of the entrance to the courtyard. Under the road, the current provincial SP6, there was the exedra with meadows planted with fruit trees, the vineyardList of minor planets: 438001–439000 (274 words) [view diff] exact match in snippet view article find links to article
— September 8, 2008 Kitt Peak Spacewatch · 750 m MPC · JPL 438710 2008 SP6 — September 5, 2008 Kitt Peak Spacewatch · 770 m MPC · JPL 438711 2008 SG7List of American Chopper: Senior vs. Junior episodes (672 words) [view diff] exact match in snippet view article find links to article
Center project at NYC's Ground Zero in front of mayor Michael Bloomberg. SP6 Special–4 "Best Pranks" November 28, 2011 (2011-11-28) N/A 39 Senior, JuniorList of minor planets: 417001–418000 (274 words) [view diff] exact match in snippet view article find links to article
2006 SX5 — March 7, 2005 Socorro LINEAR · 1.5 km MPC · JPL 417493 2006 SP6 — September 16, 2006 Palomar NEAT · 960 m MPC · JPL 417494 2006 SX33 — SeptemberList of minor planets: 420001–421000 (274 words) [view diff] exact match in snippet view article find links to article
— October 15, 1996 Kitt Peak Spacewatch EOS 1.9 km MPC · JPL 420731 2012 SP6 — March 15, 2007 Kitt Peak Spacewatch L5 10 km MPC · JPL 420732 2012 SR34List of United States servicemembers and civilians missing in action during the Vietnam War (1968–69) (6,584 words) [view diff] exact match in snippet view article
Retrieved 14 November 2012. "Larry Jamerson, SP6". The Virtual Wall. Retrieved 14 November 2012. "Frankie Johnson, SP6". The Virtual Wall. Retrieved 14 NovemberList of minor planets: 441001–442000 (274 words) [view diff] exact match in snippet view article find links to article
2007 SD5 — October 25, 2003 Socorro LINEAR · 1.2 km MPC · JPL 441103 2007 SP6 — September 21, 2007 Catalina CSS AMO +1km · critical 850 m MPC · JPL 441104List of virus species (27,221 words) [view diff] exact match in snippet view article find links to article
esscess Zicotriavirus ZC03 Zicotriavirus ZC08 Zindervirus BP12B Zindervirus SP6 Zindervirus UAB78 Zinnia leaf curl betasatellite Zitchvirus verity ZitchvirusList of minor planets: 458001–459000 (274 words) [view diff] exact match in snippet view article find links to article
— September 7, 2004 Kitt Peak Spacewatch · 490 m MPC · JPL 458759 2011 SP6 — December 4, 2008 Mount Lemmon Mount Lemmon Survey · 590 m MPC · JPL 458760List of Jupiter trojans (Trojan camp) (400001–500000) (171 words) [view diff] exact match in snippet view article
Haleakala 5.144 0.095 21.3 4.656 5.632 11 km – catalog · MPC · JPL (420731) 2012 SP6 15 March 2007 Spacewatch Kitt Peak 5.172 0.036 11.2 4.987 5.356 10 km – catalog ·List of minor planets: 585001–586000 (274 words) [view diff] exact match in snippet view article find links to article
2018 ST4 — January 2, 2014 Catalina CSS · 2.7 km MPC · JPL 585469 2018 SP6 — January 15, 2010 Mount Lemmon Mount Lemmon Survey · 940 m MPC · JPL 585470List of human protein-coding genes 4 (17 words) [view diff] exact match in snippet view article find links to article
HGNC:11208 Q02447 15534 SP4 HGNC:11209 Q02446 15535 SP5 HGNC:14529 Q6BEB4 15536 SP6 HGNC:14530 Q3SY56 15537 SP7 HGNC:17321 Q8TDD2 15538 SP8 HGNC:19196 Q8IXZ3List of minor planets: 602001–603000 (274 words) [view diff] exact match in snippet view article find links to article
1, 2014 Mount Lemmon Mount Lemmon Survey · 1.9 km MPC · JPL 602865 2014 SP6 — January 26, 2006 Kitt Peak Spacewatch · 2.4 km MPC · JPL 602866 2014 SN172024 Nürburgring Langstrecken-Serie (230 words) [view diff] exact match in snippet view article find links to article
Purpose-built racecars with an engine capacity between 2501 and 3000 cc. SP6 Purpose-built racecars with an engine capacity between 3001 and 3500 cc.List of human transcription factors (81 words) [view diff] exact match in snippet view article find links to article
ENSG00000204335 C2H2 ZF Known motif – In vivo/Misc source [868] ACCVCGCCKCCSS SP6 ENSG00000189120 C2H2 ZF Inferred motif from similar protein – High-throughput2023 Nürburgring Langstrecken-Serie (571 words) [view diff] exact match in snippet view article find links to article
Purpose-built racecars with an engine capacity between 2500 and 2999 cc. SP6 Purpose-built racecars with an engine capacity between 3000 and 3499 cc.List of minor planets: 677001–678000 (274 words) [view diff] exact match in snippet view article find links to article
1, 2011 Mount Lemmon Mount Lemmon Survey · 2.2 km MPC · JPL 677092 2016 SP6 — September 22, 2016 Mount Lemmon Mount Lemmon Survey · 1.9 km MPC · JPL